Using an sgRNA (targeting GAAGATTTGCTCCTGAACGA) with CRISPR/Cas9 technology, the GFP fluorescent reporter gene was inserted upstream of the Nfil3 start site with a linker sequence (coding for GGSG) in-between, and a loxP site flanked neomycin resistance gene cassette was inserted 411 bp upstream of the Nfil3 coding sequence. The neo cassette was removed through subsequent Cre-mediated recombination. This allele expresses a chimeric GFP-Nfil3 peptide. (J:334296)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count