Using zygotes that already carry the Rr253em3Kmm NFIL3C/EBP binding site 1-deletion allele, binding sites 2 and 3 in the Zeb2 enhancer, located ~165 kb upstream, were targeted with sgRNAs (targeting ATTTTGCAACCCCCCAAAAA and CCGGTGACACACACTGCTCA) and an ssODN template (TGGGGGAATGAATCATCAAAATAACCGGTGGAAAACAAGCTAGATCTGAGTTGAGCAGTGTGTGTCACCGGCTGGTGGAATTTTTAGAAAGGCAGCAGTTTGGGCTCATCACTGCGGTTCCTGATTGCACACACCTGTTTGGGGCATGGAGTCGACCTCCCCCCAAAAAGGGGAAACTGAACTCACTGCTCCTCCTGAG) using CRISPR/Cas9 technology, resulting in an allele lacking binding sites 1 and 3. (J:334296)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count