Exons 1 and 4 were targeted with two sgRNAs (targeting GGAGCTCAATCGACGCCTGG and GCACAGGAGACCCTACTAAA) using CRISPR/Cas9 technology, resulting in an 8 bp deletion in exon 1 (CGCCTGGA chr3:87878561-87878568 (GRCm39)) that creates a reading frame shift and premature stop codon. (J:314040)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count