Bpifb6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTACAATGAGAACTGAG and CACAGCGTGCAAAATTACCA, which resulted in a 1177 bp deletion beginning at Chromosome 2 position 153,903,913 bp and ending after 153,905,089 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000555395, ENSMUSE00000555393, and ENSMUSE00000555390 (exons 5, 6, and 7) and 867 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 12 amino acids later. (J:188991)