Ranbp3l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAGGCAAAAAGTGAGCAG and CCAGCTGTCCAACATCAGAG, which resulted in a 561 bp deletion beginning at Chromosome 15 position 9,007,125 bp and ending after 9,007,685 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001434081 (exon 7) and 418 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 2 amino acids later. (J:188991)