Dhx57^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTATTGCTCCTAGGGAC and AGATGAAACCAGCAACTGAA, which resulted in a 1411 bp deletion beginning at Chromosome 17 position 80,274,741 bp and ending after 80,276,151 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000251581 and ENSMUSE00000251553 (exons 4 and 5) and 386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 129 and early truncation 11 amino acids later. (J:188991)