CRISPR/Cas9 technology targeting the coding region generated a 25-bp deletion (c.108_132delAGTCCCCGACCGGGCTCCTCCGGTG), resulting in a frameshift mutation p.S36fsX67 and disrupting the reading frame. While mRNA levels are dramatically decreased, Western blot analysis confirmed absence of protein in the brain of homozygotes. (J:334013)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count