CRISPR-targeting using sgRNAs AGTGTTTTTGATCCAATAG and TGGAAGTGAGCTCATCTACG deleted the region between Tas2r143 and Tas2r126, which includes Tas2r143, Tas2r135, and Tas2r126. PCR of genomic DNA, RT-qPCR of bone marrow-derived neutrophils, and direct gene sequencing confirmed the deletion of all three genes. (J:334098)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count