This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTGCCGCAGCACCACTCCAG targeting the 5' side and GATCTGGTTCGGCTCCGTAG targeting the 3' side of a critical region (ENSMUSE00001287796). This resulted in a 534-bp deletion of Chr11 from 114629233 to 114629766 (GRCm39). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count