The Vsx2 super-enhancer was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in the deletion of super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52. The deletion is 31721 bp (chr12:84579817-84611537 (GRCm39)). (J:333875)
Basic Information
Intergenic deletion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count