Plasmids encoding gRNAs (CACCGCCCAACTGAGATTGTCTGTC and AAACGACAGACAATCTCAGTTGGGC) are designed to replace the stop codon of the gene with a viral T2A oligopeptide (T2A)-3xNLS-tdTomato cassette. An FRT-flanked neo cassette was included downstream. Flp-mediated recombination removed the neo cassette. (J:333832)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count