Gdpd4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGCATTAACCAATGGTGGA and TCAATTTCATGCACAAGGAG, which resulted in a 246 bp deletion beginning at Chromosome 7 position 97,966,241 bp and ending after 97,966,486 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000269329 (exon 4) and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 13 amino acids later. (J:188991)