Atoh1 enhancer Eh2 or E3 was targeted with sgRNAs (targeting AGAGGGATCAAAGTATCTAT and GTGCATAGCACTTCCATAGT) using CRISPR/Cas9 technology, resulting in a 3033 bp deletion (chr6:64774177-64777209 (GRCm39)) including the enhancer. This allele was created in cells that already carry the Rr387em1Zyliu Atoh1 enhancer Eh1 or E0 deletion allele. (J:332270, J:333396)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count