Ubxn11^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCACATGCGGTGCTTACAGC and GGGTTCTATTCAGCCCCACA, which resulted in a 1340 bp deletion beginning at Chromosome 4 position 134,112,348 bp and ending after 134,113,687 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001252036, ENSMUSE00001260575, and ENSMUSE00001254134 (exons 5, 6, and 7) and 1113 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 26 amino acids later. There is a single bp (A) insertion at the deletion site. (J:188991)