This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAACAAATCTGGACCTGGA and GGGGAGGCACTAAGAGCAAA, which resulted in a 381 bp deletion beginning at Chromosome 2 position 38,999,936 bp and ending after 39,000,316 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001281356 and ENSMUSE00000253309 (exons 3 and 4) and 103 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 12 amino acids later. (J:188991)