Pla1a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGGCACTGAACCTCCGAG and TGAGTTGTACATGCAACGAG, which resulted in a 544 bp deletion beginning at Chromosome 16 position 38,415,170 bp and ending after 38,415,713 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130582 (exon 3) and 366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 61 amino acids later. (J:188991)