This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCAGTTTCCCGCCTGCGCCG targeting the 5' side and CTGGTACAAGGTACGAGACC targeting the 3' side flanking the critical exon (ENSMUSE00000278302). This resulted in a 688-bp deletion of Chr2 from 152,894,555 to 152,895,242 (GRCm39). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count