This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCGCCGCAGCAGCGCCCGT targeting the 5' side and CAGCCTCAACGTGGCGGCTT targeting the 3' side within the critical region (ENSMUSE00000333235). This resulted in a 512-bp deletion of Chr4 from 143,076,771 to 143,077,282 (GRCm39). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count