Guide RNA (CTCAATTAGCTCGCTGGCAA), plus mutant ssDNA oligonucleotide template (GGGCACCTGTGTCTGGTCCATTGCTCGGGAGCTAATTGAGAAAAGGTTGGTTAAACATCTAAGAGGGTAGGTGGGTGAATGCATGAAACC), is designed to create a CCAGCGA to a CTCGGGA mutation, resulting in a serine to arginine substitution at position 209 (S209R) [Myd88-201: ENSMUST00000035092.7]. Three nucleotide changes were generated for murine codon optimization as well as for screening. The S209R mutation is orthologous to the S222R mutation seen in a patient with a progressively deforming arthritis characterized by marked bony overgrowth in arthritic lesions. S209R has been associated with diffuse large B cell lymphoma and severe juvenile arthritis in humans. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count