Mmp25^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCAATTTAGGCACTCCCTG and GGAATACTGTCTCTATCAGG, which resulted in a 638 bp deletion beginning at Chromosome 17 position 23643797 bp and ending after 23644434 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136262 (exon 2) and 505 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 2 amino acids later. (J:188991)