Lrch3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATTGAACCAGTTTCCACT and TAGCTGGTGGAGCATTAGCC, which resulted in a 476 bp deletion beginning at Chromosome 16 position 32,950,234 bp and ending after 32,950,709 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001311437 (exon 2) and 331 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 16 amino acids later. (J:188991)