Gpr89^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGTCACATAAGATTTACA and CCATGGGTCGTATTCAGCAT, which resulted in a 1011 bp deletion beginning at Chromosome 3 position 96,892,679 bp and ending after 96,893,689 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216982 and ENSMUSE00001294364 (exons 4 and 5) and 802 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 44 amino acids later. (J:188991)