Extl1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAACATTCATTTCATCAGA and GACATTCCCTCAATCACAAG, which resulted in a 767 bp deletion beginning at Chromosome 4 position 134,364,315 bp and ending after 134,365,081 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001230534 and ENSMUSE00001257785 (exons 2 and 3) and 568 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 254 and early truncation 38 amino acids later. (J:188991)