Gtf2a1l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTACTGGCTCCATCTGAG and CACTGAGGCTGACAACCGGG, which resulted in a 406 bp deletion beginning at Chromosome 17 position 88,689,780 bp and ending after 88,690,185 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000138840 (exon 4) and 350 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 83 amino acids later. (J:188991)