Lmna^em1Yuzha

The BE4-Gam gene editing system using sgRNA GTGGGCGGATCCATCTCCTC was used to introduce a C to T change at position 1827 (c.1827C>T) resulting in a glycine to glycine substitution at codon 609 (p.G609G). This corresponds to the c.1824C>T, p.G608G dominant mutation seen in over 90% of cases with Hutchinson-Gilford progeria syndrome, which activates a cryptic splice site in exon 11 and produces a truncated laminin A which remains farnesylated. (J:332959)