Ppp1r36^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, AGTGTATCCTGAGATACACA and ACAAGCCCAGATGATCCAGC, which resulted in a 10249 bp deletion beginning at Chromosome 12 position 76,427,616 bp and ending after 76,437,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000449772, ENSMUSE00000449766, ENSMUSE00000449760, ENSMUSE00000449752, and ENSMUSE00000449748 (exons 4-8) and 9807 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 9 amino acids later. (J:188991)