This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCAGCTACCTGGGCAAAG and CTTGTAAGTGTGATGTTTCC, which resulted in a 2881 bp deletion beginning at Chromosome 13 position 21,981,578 bp and ending after 21,984,458 bp (GRCm38/mm10). This mutation deletes 2881 bp from ENSMUSE00000378952 (exon 1) and is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count