Dus1l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCTGGGTATTGGTGCACAT and ACTGTTGGTTCTCGACAGGA, which resulted in a 434 bp deletion beginning at Chromosome 11 position 120,794,790 bp and ending after 120,795,223 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001238047 (exon 3) and 325 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 16 amino acids later. (J:188991)