Arid3c^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATTAGTGGTGGACCCAC and GCAAGGTCTGAGCTACCTAG, which resulted in a 517 bp deletion beginning at Chromosome 4 position 41,727,825 bp and ending after 41,728,341 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527822 (exon 3) and 444 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 3 amino acids later. There is a 13 bp insertion (ACTCATTAACCTG) at the deletion site. (J:188991)