CRISPR/Cas9 mediated recombination targeting exons 2 and 3 with sgRNAs (targeting CGAGGTCTACCTTCAAGTCA and GGATGATGCAAGATACGGCA) created a 5 bp deletion mutation (CTTGA) in exon 3 resulting in a frameshift mutation at aspartic acid codon 162 (GAC) and a premature stop codon 38 nucleotides/13 codons downstream (Asp162Glufs*13). (J:322160)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count