CRISPR/Cas9 technology using gRNA GAGAAGGATGTGTGAAGGCTTGG generated a 13 bp deletion (CTTCCAAGCCTTC) resulting in a frameshift mutation in exon 11. Immunoblot analysis confirmed the complete loss of protein expression of the long isoform in skeletal and heart muscle tissue. Short isoform expression in the white adipose tissue is not affected. (J:278917)
Basic Information
(129S2/SvPas x C57BL/6N)F1
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count