CRISPR/Cas9 technology, using an sgRNA (targeting ACTTCTTCCGGAATGCACTG) and an ssODN template, generated a 116 bp deletion (chr18:77960990-77961105 (GRCm39)) encompassing part of the exon coding W323 together with a part of the preceding intron, resulting in the complete loss of expression as confirmed by Western blot analysis. (J:332442)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count