CRISPR/Cas9 technology, using an sgRNA (targeting AGATGATCCTGATTACTCTG) and an ssODN template, generated a 17 bp deletion (CTGTGGTTGAAGATTAC) resulting in a stop codon immediately after the first of the three tyrosines, Y323. While Y323 is preserved, the absence of the amino acids immediately following it is expected to result in a loss of SHIP1 SH2 domain binding. Western blot analysis confirmed expression of normal levels of mutant protein in neutrophil lysates. (J:332442)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count