CRISPR/Cas9 technology, using an sgRNA (targeting AGATGATCCTGATTACTCTG) and an ssODN template, generated a TAC to TTT change resulting in a tyrosine to phenylalanine substitution at amino acid 323 (p.Y323F) in exon 14. In addition, sequence of BspEI restriction cleavage site was introduced by changing the second T to G in the TCCTGA sequence. Western blot analysis confirmed expression of normal levels of mutant protein in neutrophil lysates. (J:332442)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count