This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGGTGCTAGGATAACCTA targeting the 5' side and TATAGGCACATTCAGCTCGC targeting the 3' side of a critical region (ENSMUSE00000173482, ENSMUSE00000173486, ENSMUSE00000173485, ENSMUSE00000173480 and ENSMUSE00000173487) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 3,107-bp deletion (Chr3:104,707,954 to 104,711,060, GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCGGT). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count