This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGTTGCTCGGCTCGATAC and AGAGGGCTGCTTCTCCGGTA traversing the critical region (ENSMUSE00000316881 and ENSMUSE00000371215). This resulted in a 2794-bp deletion of Chr10 from 33,917,226 to 33,920,020 with insertion of TACCC (GRCm39). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count