The putative Pitx2 AF (atrial fibrillation)-related enhancer, located upstream of the gene, was targeted with sgRNAs (targeting GCTGGGAGATACAAAGCCAGG, GCTATTGTTAATGAAGACCA, GAGACACTAATCCAGCCCTG and GCCAAACTATACCCTTCAATG) using CRISPR/Cas9 technology, resulting in an ~62 kb deletion. The deleted sequence contains predicted enhancer Rr791245. (J:281534)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count