Cardiac-specific Scn5a enhancer Rr207838, part of a super-enhancer between Exog and Scn5a that also contains enhancers Rr207840 and Rr207839, was targeted with sgRNAs (targeting GGTCTGAGTACCGTAGATGA and GGCACTATTTGAGTTCCACT) using CRISPR/Cas9 technology, resulting in its deletion (~2.3 kb sequence total deleted). (J:281596)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count