The super-enhancer between Exog and Scn5a, containing cardiac-specific Scn5a enhancers Rr207838, Rr207839 and Rr207840, was targeted with sgRNAs (targeting GGCACTATTTGAGTTCCACT and GGGAGCCGAGGGCGCTCCTT) using CRISPR/Cas9 technology, resulting in an ~9.9 kb deletion of the sequence containing Rr207839 and Rr207840. (J:281596)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count