Shkbp1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGAATTCCCATCCCCCCA and GATTTGGGTGTAAAAATCTA, which resulted in a 3202 bp deletion beginning at Chromosome 7 position 27,351,614 bp and ending after 27,354,815 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254966, ENSMUSE00001289332, ENSMUSE00001286326, ENSMUSE00001209769, and ENSMUSE00001275973 (exons 5-9) and 2618 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 48 amino acids later. (J:188991)