Cacng4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCACACGGGAGTCGTCCGC and TGATACCGATGATATTACTG, which resulted in a 516 bp deletion beginning at Chromosome 11 position 107,734,797 bp and ending after 107,735,312 bp (GRCm38/mm10). This mutation deletes 516 bp from ENSMUSE00000370668 (exon 4) and is predicted to delete 172 amino acids after amino acid residue 150 and then terminate 5 amino acids later. (J:188991)