Tbc1d12^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGACTTATGCAAATGTTT and TTTCACTATGTACAAATTTG, which resulted in a 413 bp deletion beginning at Chromosome 19 position 38,865,432 bp and ending after 38,865,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000319961 (exon 2) and 289 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 247 and early truncation 31 amino acids later. (J:188991)