Grid1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGTGATTCTGGCATAGCTT and ATTGAGGCAGTAACATATGC, which resulted in a 672 bp deletion beginning at Chromosome 14 position 35,026,496 bp and ending after 35,027,167 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000461599 (exon 4) and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 173 and early truncation 17 amino acids later. (J:188991)