CRISPR-cas9 meidated recombination using guide RNAs (gRNA1:GTGCCTCATTGGGAGCACCG; gRNA2:CTGTACAGTCTCACACCAAG) targeting exons 2 and 3 created a deletion removing part of exon 2 and all of exon 3. Western blot and qPCR analyses confirmed the absnece of expression in homozygous mice. (J:329548)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count