This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTACTCAAGTGATAGCAGT and GAGCACCTGAAGCAGAATCC, which resulted in a 1970 bp deletion beginning at Chromosome 14 position 101,435,012 bp and ending after 101,436,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364724 (exon 3) and 175 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count