The centromeric part of the Sox9 topologically associated domain (TAD), including border (insulator) region Rr325 that separates it from the Kcnj TAD, was targeted with sgRNAs (targeting ATCATTTTAGGTAACGACCC and GAAGCAAATACGTGAGTCTAC) using CRISPR/Cas9 technology, resulting in its inversion. (J:282642)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count