Boundary region (insulator) Rr325 between the topologically associated domains (TADs) that contain the Kcnj16 and Kcnj2 genes and Sox9, respectively, was targeted with sgRNAs (targeting GATCATTTTAGGTAACGACCC and GATTTAGCGTCCCCTAGCATA) using CRISPR/Cas9 technology, resulting in an 18.342 kb deletion (chr11:111413371-111431712 (GRCm39)). (J:235642)
Basic Information
(129S6/SvEvTac x C57BL/6NCrl)F1
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count