The transgene contains the following elements: SV40 transcriptional terminator sequence, three copies of OAP/P1 (octamer-associated protein/P sequence-binding nuclear factor) binding site sequence (CTGGTGTAATAATAAAATTTTCCAATGT) from mouse Il4 promoter/enhancer, Il4 promoter sequence (-58 to + 60 bp with respect to TATA box start), the luciferase gene, and SV40 poly(A) signal sequence. A total of six mouse lines were created (#5, 41, 78, 96, 104, 158), with transgene copy numbers of 5-12. (J:40450)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count