This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACAGGTCCTATGTCATGT and AAGCTACAGTAACGTAACCA, which resulted in a 2192 bp deletion beginning at Chromosome 1 position 37,880,718 bp and ending after 37,882,909 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000155673, ENSMUSE00000155677, and ENSMUSE00001272681 (exons 3,4,and 5) and 1852 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 6 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count