Tjap1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGTGGCCACAACATAGCG and GGGTTACTAAATAAAGTCAG, which resulted in a 468 bp deletion beginning at Chromosome 17 position 46,260,872 bp and ending after 46,261,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136628 (exon 8) and 401 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 17 amino acids later. (J:188991)